Format Conversion
-Combine FASTA
-EMBL to FASTA
-EMBL Feature Extractor
-EMBL Trans Extractor
-Filter DNA
-Filter Protein
-GenBank to FASTA
-GenBank Feature Extractor
-GenBank Trans Extractor
-One to Three
-Range Extractor DNA
-Range Extractor Protein
-Reverse Complement
-Split Codons
-Split FASTA
-Three to One
-Window Extractor DNA
-Window Extractor Protein
Sequence Analysis
-Codon Plot
-Codon Usage
-CpG Islands
-DNA Molecular Weight
-DNA Pattern Find
-DNA Stats
-Fuzzy Search DNA
-Fuzzy Search Protein
-Ident and Sim
-Multi Rev Trans
-Mutate for Digest
-ORF Finder
-Pairwise Align Codons
-Pairwise Align DNA
-Pairwise Align Protein
-PCR Primer Stats
-PCR Products
-Protein GRAVY
-Protein Isoelectric Point
-Protein Molecular Weight
-Protein Pattern Find
-Protein Stats
-Restriction Digest
-Restriction Summary
-Reverse Translate
-Translate
Sequence Figures
-Color Align Conservation
-Color Align Properties
-Group DNA
-Group Protein
-Primer Map
-Restriction Map
-Translation Map
Random Sequences
-Mutate DNA
-Mutate Protein
-Random Coding DNA
-Random DNA Sequence
-Random DNA Regions
-Random Protein Sequence
-Random Protein Regions
-Sample DNA
-Sample Protein
-Shuffle DNA
-Shuffle Protein
Miscellaneous
-Home
-IUPAC codes
-Genetic codes
-Browser compatibility
-Mirror this site
-Use this site off-line
-About this site
-Acknowledgments
-Reference
The Sequence Manipulation Suite Copyright © 2000, 2004 Paul Stothard. Send questions and comments to
[email protected]
home
Sequence Manipulation Suite:
DNA Pattern Find
DNA Pattern Find accepts one or more sequences along with a search pattern and returns the number and positions of sites that match the pattern. Use DNA Pattern Find to locate sequence regions that match a consensus sequence of interest.
Paste a raw sequence or one or more FASTA sequences into the text area below. White space and digits are removed before the pattern matching is performed. Input limit is 500,000,000 characters.
>sample sequence one ttaaggaccccatgccctcgaataggcttgagcttgccaattaacgcgcacgggctggccgggcgtataagccaaggtgtagtgaggttgcattatacatgccggcttgtgattaacgcatgccataggacggttaggctcagaacccgcaaccaatacacgtgattttctcgtcccctg >sample sequence two aggcgtatgcgatcctgaccatgcaaaactccagcgtaaatacctagccatggcgacacaaggcgcaagacaggagatgacggcgtttagatcggcgaaatattaaagcaaacgacgatgacttcttcgggaaattagttccctactcgtgtactccaattagccataacactgttcgtcaagatatagggggtcacccatgaatgtcctctaaccagaccatttcgttacacgaacgtatct >sample sequence three tactcagggctccagaggtacaagttggtaatcggttaggtgtatcgccgccaggggtgcgtcgtcatgactcggttaga
Enter the
search pattern
to be used. The default pattern "ctt[ca]" searches for occurrences of "cttc" and "ctta".
*This page requires JavaScript. See
browser compatibility.
*You can
mirror this page
or
use it off-line
.
new window
|
home
|
citation
Sun 1 Oct 12:00:06 2023
Valid XHTML 1.0; Valid CSS